DNA to Text



Insert DNA.





DNA Storage and the future of information technology

As the necessity of data storage increases, new forms of technology develop to deal with the problem of long term storage, avoidance of data loss and storage physical space.

Here comes the DNA!

DNA encoded all the information on the genomes of its organism in a single cell using only 4 bases (A, C, G, T). The human genome for example has 3 billion bases and the largest genome described so far Paris japonica (a flower) has 150 billion! All condensed in a single cell, so physical space is not a problem for DNA storage.

Studies shows that DNA data information can be recoved after up to 1 million years if stored in at -18°C (a household freezer) and 2000 years if stored at 10°C (a bit over your fridge!)

Researchers showed all data in the world could be stores in a single cold room.

The process to code information, like messages, text, mp3 or pdf files, into DNA is called DNA Digital Data Storage.

DNA digital data storage refers to any process to store digital data in the base sequence of DNA using commercially available DNA synthesis machines for storage and DNA sequencing machines for retrieval.

Ribbon Biolabs technologies will enable massive synthesis of DNA, which can be used to hold large databanks of information in simple micro-tube in your freezer!

The following table shows an example on how DNA can be used to store digital information.

Binary Digital Code Character DNA translation code
01010010 Letter 'R' CCAG
00100011 Hash symbol '#' AGAT
00000110 Number '6' ATCG
01000010 Letter 'B' CAAG
00111111 question mark '?' ATTT

How does this works??

Digital information (e.g. your computer files, music and photos) are stored in binary data (zeros and ones) to be stored in a language the machines can understand.

The examples above uses a simple code:

DNA base Binary code
A 00
C 01
G 10
T 11

In this way any message or file can be converted in binary code and than converted to DNA, the reverse is also true, any DNA sequence can be retrieved as binary code and converted to messages or files.

For example: CCAGCGGCCGAGCGAGCGTTCGTGAGAACAAGCGGCCGTTCGTACGACCGAGCTAT reads as Ribbon Biolabs!